Id Trinity | TRINITY_DN48187_c2_g1_i3 |
---|---|
Name Transcript | Ll_transcript_507869 |
Sequence | AGTTTGATTGTCAAAAATATGGAAGACCTGATAAACAGTACCTCAAATATGCTTGGAAGCCTGATTCATGTGCCTTACCAAGGTACTGCTGAAACCTTGC TCTTCCAATATTCTATGTTTGAAGCATCACCAATGAAATGGTTTGATGGGGTGGATTTGTTGAAAAGGTGGAAAGAAAAGAAGATAATGTTTGTTGGAGA CTCATTGAGTCTGAACAT BLAST |
Tissue | pods |
Gene name | LI_gene_158871; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_507869
Blastp | - |
---|---|
Blastx | Protein trichome birefringence-like 37 from Arabidopsis with 71.43% of identity |
Eggnog | function domain containing protein, expressed(ENOG410YAJT) |
Kegg | Link to kegg annotations (AT2G34070) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019420009.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |