Id Trinity | TRINITY_DN48263_c2_g5_i1 |
---|---|
Name Transcript | Ll_transcript_304273 |
Sequence | CCTAAGGTGGTAATAGCTGGTTCCGAACGTAGATTTTGCCAGCAATGTAGCAGGTTTCATGGTCTGTCAGAATTTGATGATAAAAAAAGAAGCTGCAGAC AACGTCTTTTAGATCACAACGCAAGGCGCCGCAAGGCGCATCCTGATGCAGTGCGATTAAATACGTCGGCTTTGTCTTCATCACCCTATGGTATAGAAGA TCCTATAACCTCTTCTAATATGAATGCTACACAAGATGTTAACTATGCTCTCTCTCTTCTGTCAAACAACTCATCATGGAATACTGCATATGAGACCAAC TCCTTCTCCATAACâBLAST |
Tissue | pods |
Gene name | LI_gene_159552; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_304273
Blastp | Squamosa promoter-binding-like protein 2 from Arabidopsis with 40.4% of identity |
---|---|
Blastx | Squamosa promoter-binding-like protein 3 from Oryza sativa with 71.43% of identity |
Eggnog | Squamosa promoter-binding-like protein(ENOG410YKP9) |
Kegg | Link to kegg annotations (AT5G43270) |
CantataDB | Link to cantataDB annotations (CNT0002898) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019438295.1) |
Pfam | SBP domain (PF03110.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |