Id Trinity | TRINITY_DN48505_c1_g9_i2 |
---|---|
Name Transcript | Ll_transcript_339066 |
Sequence | AGGACTTGATGGTGGAATGAATAAACTTTCCAAAACCAACCAACCCCAACTGAGCCGAAGCCGAAAGCACCGTAACCAATGTAGCCTCATTAGGTCTTAT TCCTCTCTCCCTCATCTCTCTAAAACACTCCAACCCATCTTTCAAGATTCCGTTTTGCACATACCCCATCACCATGGTGCTCCAAGAGATAACATCTCTC TCAGGCATTTCATCAAACAGTTTCTCCGCAACACGAACCTCTCCGTTTCTAACCAAACCCGCCAACATGGAGTTCCACGTGACCACATCCCTACAAAGGG TATCTTCATCAAACâBLAST |
Tissue | pods |
Gene name | LI_gene_161623; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_339066
Blastp | Pentatricopeptide repeat-containing protein At2g42920, chloroplastic from Arabidopsis with 46.81% of identity |
---|---|
Blastx | Pentatricopeptide repeat-containing protein At2g42920, chloroplastic from Arabidopsis with 46.81% of identity |
Eggnog | Pentatricopeptide repeat-containing protein(ENOG410Z7Z7) |
Kegg | Link to kegg annotations (AT2G42920) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019439277.1) |
Pfam | PPR repeat (PF12854.6) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |