Id Trinity | TRINITY_DN48519_c1_g1_i15 |
---|---|
Name Transcript | Ll_transcript_337080 |
Sequence | AGGTGGTACCTTTGCATTATACTCACTTCTCTGCCGACATGCAAAACTAAGCATTTTACCTAATCAACAACCCACAGACGAAAACTTGTGTGCTTATGAT GCCAGTGCCATAGAAGATTCTGAAGACACATGGCAGAGTTCTTTTTTGAAGCTATTCTTTAAAAAGCACCCAAGGTTCCAGAAAGGACTACTGATATTTG TTCTGCTAGGAACCTGTATGACAATTGGTGATGGTGTGATTACTCCTGCAATATCAGTTTCGGGTGTTAAAGTTAAGATCAGTCAACTCCATGACAATTA TGTTGTTATGATCTCATGTGTCATTTTAGTGGG BLAST |
Tissue | pods |
Gene name | LI_gene_161710; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_337080
Blastp | Potassium transporter 1 from Arabidopsis with 64.04% of identity |
---|---|
Blastx | Potassium transporter 1 from Arabidopsis with 64.04% of identity |
Eggnog | Transport of potassium into the cell (By similarity)(COG3158) |
Kegg | Link to kegg annotations (AT2G30070) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019460287.1) |
Pfam | K+ potassium transporter (PF02705.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |