Id Trinity | TRINITY_DN48546_c3_g11_i2 |
---|---|
Name Transcript | Ll_transcript_338653 |
Sequence | AAGAAATGGTAAGCGAATTCAATTCTATTTATTCAATTGAATTTAAATTCATAATCTTGATTAGTAGCACCAATTGAGAATAATTGATTTTATTGTTATT GTCATGGTAAGGTTTATCACTCTAGTTTTGTGGATGAAAATGGAGTAAATATAGCTTGTGGGTGCCCTTTACTTCCTCTTAAGAGCCACATTAAGGGACC TGCTCCTGTTTCAGATCAAG BLAST |
Tissue | pods |
Gene name | LI_gene_161978; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_338653
Blastp | - |
---|---|
Blastx | Actin-related protein 2/3 complex subunit 3 from Arabidopsis with 88.89% of identity |
Eggnog | protein 2 3 complex, subunit(ENOG4111FTG) |
Kegg | Link to kegg annotations (AT1G60430) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440816.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |