Id Trinity | TRINITY_DN48705_c0_g3_i1 |
---|---|
Name Transcript | Ll_transcript_420949 |
Sequence | CCCACATCTTCCTAAACACTTCAATTGCCTCCTTAAACCTGTCTTGAGCACAATATCCATCCGCCATCACGTTAAAACTCCCCAAATTCAACGCCAAACT TCTCGGTGGCGCATGCTCCCTTATCATCCTATCAAACAGCACCAAAGCCTCATCAAACTTCCCATTCTTGCTCAATGCATCAAGCACTGAATTATAACCC ACAGCACTCATCTTCACTTTCGAATCCACCCCAAGAGCTTCCTCATAACACTCCATAGCCTCCTTCTCCATCCCCCTTAGAAAATACCCTTTCATCAAGC TCCCATACACAACCCCATCGTCCAACTCACCACCCAATTTCCCCTTCAAATCCTCGTAAAGCTCAAAAACACGATCCGAATCAGAACCâBLAST |
Tissue | pods |
Gene name | LI_gene_163399; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_420949
Blastp | Pentatricopeptide repeat-containing protein At3g49240, mitochondrial from Arabidopsis with 68.75% of identity |
---|---|
Blastx | Pentatricopeptide repeat-containing protein At3g49240, mitochondrial from Arabidopsis with 70.87% of identity |
Eggnog | Pentatricopeptide repeat-containing protein(ENOG410Z7Z7) |
Kegg | Link to kegg annotations (AT3G49240) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019417345.1) |
Pfam | PPR repeat (PF01535.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |