| Id Trinity | TRINITY_DN48870_c0_g4_i8 |
|---|---|
| Name Transcript | Ll_transcript_285828 |
| Sequence | TTTTGGCAAAAGGAGGCAGGCATTTTAAGGCAGCAACTACAGAATCTACAAGAAAACCACCGGCAATTGATGGGAGAACAACTTTACGGTTTGAGTGTCA GAAACCTACAAGATCTTGAGAATCAACTGGAAATGAGTCTCCAAGGTGTCCGCATGAAAAAGGAACAAAATCTAACAGAAGAAATTCAAGAGCTGAACCG AAAGGGAAATCTTATCCATCAGGAAAATGTGGAACTTTATAAGAAAGTGAATATCATTCAACAAGAAAACATGCAATTATGCAAAAAGGTATCCTGGTTT AGTTACCTTATCTGGCATCCCCAAAAATTACAAGATCCG BLAST |
| Tissue | pods |
| Gene name | LI_gene_164681; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_285828
| Blastp | Agamous-like MADS-box protein AGL16 from Arabidopsis with 71.43% of identity |
|---|---|
| Blastx | Agamous-like MADS-box protein AGL16 from Arabidopsis with 71.43% of identity |
| Eggnog | Transcription factor(COG5068) |
| Kegg | Link to kegg annotations (AT3G57230) |
| CantataDB | Link to cantataDB annotations (CNT0002701) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019420953.1) |
| Pfam | K-box region (PF01486.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |