Id Trinity | TRINITY_DN49000_c7_g1_i4 |
---|---|
Name Transcript | Ll_transcript_330387 |
Sequence | CACGAAACGTCTTAAAGAGAGCGACCTGGTCGTGACTCAGCCAGTAATGATTATCTCGTGTCATTTATAATTGTTGCAAGCTACTCTATCTATGGTGGGT TGAGGAGTATCAGATTGATGGGTTTAGGTTCCATTCTGTTTCATCTATGATATACAGTCACAATGGTTTTGCTACTTTTACTGGTGACTTGGAGGAGTAC TGCAACCAATATGTCGACAAGGATGCACTGTTATATCTTATCTTAGCCAATGAGATACTACATTTTTTTTACCCAAATATTATCACAATAGCAGAAGATG TAAGTATTTGTTATTTCATAGTTGGATACTTTTGCACATAGCACTTGATGAAAAGTACACAGAAAATGTCAATT BLAST |
Tissue | pods |
Gene name | LI_gene_165708; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_330387
Blastp | - |
---|---|
Blastx | 1,4-alpha-glucan-branching enzyme 3, chloroplastic/amyloplastic from Arabidopsis with 71.83% of identity |
Eggnog | Catalyzes the formation of the alpha-1,6-glucosidic linkages in glycogen by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position (By similarity)(COG0296) |
Kegg | Link to kegg annotations (AT3G20440) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440691.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |