Id Trinity | TRINITY_DN49051_c7_g1_i2 |
---|---|
Name Transcript | Ll_transcript_330432 |
Sequence | CCAAAAACAAGTGACCCGAATAAGCCTGCGGGTATCAACAGTAGTTCTATAGATGGTCTGAACACCGGCAACTTCATAACGGACCGACCTTCGACCAAGG TGCATGCTGCACCTGGCGGTGGCTCTTCTCTGGGATACCTCTTTGGTGGGCCTGGTGATGCAAACTAATACCTTGGTTGTGAAGCTTTTGCATGAAGAAT GTTTTTCTTTTGAAATTCA BLAST |
Tissue | pods |
Gene name | LI_gene_166150; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_330432
Blastp | - |
---|---|
Blastx | Protein SPIRAL1-like 1 from Arabidopsis with 71.43% of identity |
Eggnog | in maintaining the cortical microtubules organization essential for anisotropic cell growth(ENOG410XU77) |
Kegg | Link to kegg annotations (AT1G26355) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019428788.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |