Id Trinity | TRINITY_DN49141_c0_g3_i10 |
---|---|
Name Transcript | Ll_transcript_292576 |
Sequence | TTTTCATGGTTCCTGGCAAATGCATTCACCAGATTTATCTTCTCACATGTTTTCTCATGTTGGTGGGAGTAGCACTGAACTGACGCCGAATGCTGTGCAG TCCTCTTCTAAGAAGTTGTCACATGTTTCCTCTGGGAGGCAACCTACTTCATTGTCAAAATTTGATTCTACTAATGAACGGATGAGAAATCTTCATCATC GTAGAAGTGAAGCAAACACTAAAAATGCTGATAAAAAACAGTTTGAGCTCGACTTAGGTAGCATATTGCGTGGGGAAGACAGCCGAACAACTCTTATGAT AAAAAACATTCCCAA BLAST |
Tissue | pods |
Gene name | LI_gene_166884; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_292576
Blastp | Protein MEI2-like 4 from Arabidopsis with 60.87% of identity |
---|---|
Blastx | Protein MEI2-like 4 from Arabidopsis with 58.33% of identity |
Eggnog | Rna-binding protein(ENOG4111R9F) |
Kegg | Link to kegg annotations (AT5G07290) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019463986.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |