Id Trinity | TRINITY_DN49150_c1_g2_i1 |
---|---|
Name Transcript | Ll_transcript_291486 |
Sequence | GGAAGCCATAGGGTATGGTATTGCCGACAAAATCATTGATTCAAGGGATGCTACATTTGATAAGCGGAATTATGATGAAATGGTTGGTCAATCAAGAGCA ACAAGGAGACAAGCTGGTGGCAATCCTCAAGTTGCTCCAACAGGATTTAGTTGACCTGTCATATGATCGGAAAAGGTTTAGTTCTGCGTTGAAAGCCACA TTTACATTGATTGGATTCAAGCTAGTTATTCAATCACAGATATGTTGGCTTCAATGGCGGAGGCTGCGTCTTTCCATAATGCTGACTCGGAAATTGAGGT TGATGCACAACACAGCATCATATCAGAT BLAST |
Tissue | pods |
Gene name | LI_gene_166972; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_291486
Blastp | - |
---|---|
Blastx | ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic from Arabidopsis with 56.25% of identity |
Eggnog | Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740) |
Kegg | Link to kegg annotations (AT1G49970) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019428782.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |