Ll_transcript_292839

• Id Trinity: TRINITY_DN49154_c0_g3_i15
• Name Transcript: Ll_transcript_292839
• Sequence: TTCTTTTCCATTCATTCTCATACAATTCTCTCTCTCCGTTTTTTATCTTCTTCCTTCATTCTTCATCCAAGGCACAATACTTTCATCCTTAACATTTTTA TCTTCTTCTTCCTTCATTCTTCATCCAAGGCACAATATTTTCATCCTTTAAATAGATCAGTGGAAACTTTATTTAGAGTTGGTAGCTGAGGTGGCGGGAA CATATTTTTTTGATATTTACAAGGTGTGCATCAATGGTAGTGAACAAAAGGTATGATAATGTGGTAACACTTCTTGGGATTGCAATTGCTTGGGGATTGG TTGTGATGGTTATATAACCGTTGTTATTATACAATG
• Tissue: pods
• Gene name: LI_gene_167028;
• Additional information: -

Expression of Ll_transcript_292839

FPKM

• PAB: 0
• PNAB: 0.8
• PS1: 0.7
• PS2: 0
• PS3: 0.3
• PW1: 1.3
• PW2: 0.8
• PW3: 2.2

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_292839

• Blastp: -
• Blastx: Aquaporin NIP1-1 from Arabidopsis with 69.44% of identity
• Eggnog: Channel that permits osmotically driven movement of water in both directions. It is involved in the osmoregulation and in the maintenance of cell turgor during volume expansion in rapidly growing cells. It mediates rapid entry or exit of water in response to abrupt changes in osmolarity (By similarity)(COG0580)
• Kegg: Link to kegg annotations (AT4G19030)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019464796.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;