Id Trinity | TRINITY_DN49161_c3_g1_i2 |
---|---|
Name Transcript | Ll_transcript_291612 |
Sequence | GTAACTGTTACTGCTGTTTCGTTTGCTCATTCAGTTGCAGGTGTTGTTGTTGAGGTTTCCGGGGATCCATCCTGTCGTGTGATACTCGGTGGAGAGATCT TCATAATAATACTAACAATTATGCTACTCACATAGTTCCTAAGGGAGATGGATGTCATGCAAAGTGCACTCCCAAAGCTCTTTAAACCATCTGGTGTTTG AGCATTGAAAAA BLAST |
Tissue | pods |
Gene name | LI_gene_167058; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_291612
Blastp | - |
---|---|
Blastx | Protein NRT1/ PTR FAMILY 7.3 from Arabidopsis with 81.48% of identity |
Eggnog | transporter(COG3104) |
Kegg | Link to kegg annotations (AT1G32450) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421849.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |