Id Trinity | TRINITY_DN49276_c13_g1_i2 |
---|---|
Name Transcript | Ll_transcript_466182 |
Sequence | TCCAGGTTCTAAGGAACCTCAATTATGGAATGATATCTGGAAATTCTTTGAGAAAGCATCTGTTCTTGAATTTGAAGAGAGTAAAATGCATAAGACTTAT GAGACAATTTCATTCAGGGAAGTCCATGATGAAATTGTCGAGCTCAAGGGATTGACTGACCGTCTAAATTCCCCTGTAATATTTTCTCACAATGACTTGC TGTCTGCAAACATCATGATTAATGATGATGAAGATAAAATTTATTTCATTGATTATGAATATGCATCATACAACTACAGAGGCTTTGATATAGCAAACCA CTTCGâBLAST |
Tissue | pods |
Gene name | LI_gene_167968; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_466182
Blastp | Probable ethanolamine kinase from Arabidopsis with 67.33% of identity |
---|---|
Blastx | Probable ethanolamine kinase from Arabidopsis with 67.33% of identity |
Eggnog | Ethanolamine kinase(COG0510) |
Kegg | Link to kegg annotations (AT2G26830) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019415990.1) |
Pfam | Choline/ethanolamine kinase (PF01633.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |