Id Trinity | TRINITY_DN49458_c2_g2_i10 |
---|---|
Name Transcript | Ll_transcript_355154 |
Sequence | AGGATTTGTTACTGAAGAAGGTAGTAGAAAGAGTCTCAAACAGATTGGTTTTCAACAGATAGTACATGATGATAAAATGTTGGTGAGGGCTAGGATAGGG TCAAGGCCACCTAAATGTGAGAAAAGGTGTAGATCTTGTGGACCTTGTGAGGCTATTCAGGTGCCTACAAATCCCCAAGCTCACAATGGCAAGATCAACA TCAACCCTTATACAGTGTCTACAAATGCTTATGAAAGGGGTGAAGGCAATGTTAACTACAAGCCCATGAGTTGGAAGTGTAAATGTGGGAACCATATTTT CAACCCTTAATTCCATTTGTAC BLAST |
Tissue | pods |
Gene name | LI_gene_169529; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_355154
Blastp | EPIDERMAL PATTERNING FACTOR-like protein 2 from Arabidopsis with 57.78% of identity |
---|---|
Blastx | EPIDERMAL PATTERNING FACTOR-like protein 2 from Arabidopsis with 57.78% of identity |
Eggnog | epidermal patterning factor-like protein(ENOG410YZE3) |
Kegg | Link to kegg annotations (AT4G37810) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019423757.1) |
Pfam | Epidermal patterning factor proteins (PF17181.3) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |