| Id Trinity | TRINITY_DN49458_c2_g2_i10 |
|---|---|
| Name Transcript | Ll_transcript_355154 |
| Sequence | AGGATTTGTTACTGAAGAAGGTAGTAGAAAGAGTCTCAAACAGATTGGTTTTCAACAGATAGTACATGATGATAAAATGTTGGTGAGGGCTAGGATAGGG TCAAGGCCACCTAAATGTGAGAAAAGGTGTAGATCTTGTGGACCTTGTGAGGCTATTCAGGTGCCTACAAATCCCCAAGCTCACAATGGCAAGATCAACA TCAACCCTTATACAGTGTCTACAAATGCTTATGAAAGGGGTGAAGGCAATGTTAACTACAAGCCCATGAGTTGGAAGTGTAAATGTGGGAACCATATTTT CAACCCTTAATTCCATTTGTAC BLAST |
| Tissue | pods |
| Gene name | LI_gene_169529; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_355154
| Blastp | EPIDERMAL PATTERNING FACTOR-like protein 2 from Arabidopsis with 57.78% of identity |
|---|---|
| Blastx | EPIDERMAL PATTERNING FACTOR-like protein 2 from Arabidopsis with 57.78% of identity |
| Eggnog | epidermal patterning factor-like protein(ENOG410YZE3) |
| Kegg | Link to kegg annotations (AT4G37810) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019423757.1) |
| Pfam | Epidermal patterning factor proteins (PF17181.3) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |