| Id Trinity | TRINITY_DN49567_c0_g4_i1 |
|---|---|
| Name Transcript | Ll_transcript_406574 |
| Sequence | AGAGAATCAGAACTGATCCTGACCTTGCCAATGCAAGGGCGTCGGAGGAATTCGATCCACTAGTGAAAAGATTCGACGAATCATTTATCAACGAGAATGC CATCAATGCTATTAAATCACTTTTTGGCTTTGGTCATACACTCAAATCTTTAAAACAATCTCTAAGTTATGAGGATGGTTTTGATCGGTTGGGTTTGTTT AAAGTGGATAGAGGTATCAAAGGAGAC BLAST |
| Tissue | pods |
| Gene name | LI_gene_170425; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_406574
| Blastp | - |
|---|---|
| Blastx | Protein MET1, chloroplastic from Arabidopsis with 76.74% of identity |
| Eggnog | NA(ENOG410ZEH3) |
| Kegg | Link to kegg annotations (AT1G55480) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019444187.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |