Id Trinity | TRINITY_DN49599_c1_g1_i13 |
---|---|
Name Transcript | Ll_transcript_406263 |
Sequence | GGACTTGAAATATGGCGTATTGAGAATTTTAATCCAGTTCCTATCCCAAAGTCCTCTTATGGGAAGTTTTTCACAGGGGACTCCTATGTGATCCTAAAGA CAATTGCATCGAAAAGTGGTGCTCTGCGCCATGAAATCCACTACTGGCTTGGTAAAGACACTAGTCAGGATGAAGCTGGTGCTGCGGCCATCAAGACAGT TGAGTTGGATGCAGCTCTTGGAGGACGTGCTGTACAGTATCGTGAAGTACAGAGCCATGAAACTGAAAAGTTTCTGTCTTATTTCAGACCATGTATTATA CCTCAAGAAGGâBLAST |
Tissue | pods |
Gene name | LI_gene_170708; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_406263
Blastp | Villin-4 from Arabidopsis with 86.41% of identity |
---|---|
Blastx | Villin-4 from Arabidopsis with 86.41% of identity |
Eggnog | capping protein (actin filament) gelsolin-like(ENOG410XR0A) |
Kegg | Link to kegg annotations (AT4G30160) |
CantataDB | Link to cantataDB annotations (CNT0002809) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019431513.1) |
Pfam | Gelsolin repeat (PF00626.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |