Ll_transcript_415181

• Id Trinity: TRINITY_DN49612_c0_g1_i18
• Name Transcript: Ll_transcript_415181
• Sequence: GAACTAATACCACTGTGCTGTGTTCTGCTCCTGATATAAACCCTATGGCGCTTCGTTTTGAGTTATTCTTTGAACTCCACTCTGTTCCCGTTGTCAGGTT CTTGCCAGGTTCAACCGAGCTCGTGCAGCTCGATTGACACTCCCTCACTTTGTGTGTGAAACGCCTTTATTTATGCCAGTAGGCACACAAGGGACTATAA AAGGATTGACTAATAGCCAGCTTGAGGATATTGGCTGCCA
• Tissue: pods
• Gene name: LI_gene_170792;
• Additional information: -

Expression of Ll_transcript_415181

FPKM

• PAB: 0
• PNAB: 0
• PS1: 0
• PS2: 0.6
• PS3: 0.5
• PW1: 0
• PW2: 0
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_415181

• Blastp: -
• Blastx: Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 68.57% of identity
• Eggnog: Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, resulting in the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine) (By similarity)(COG0343)
• Kegg: Link to kegg annotations (393985)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019416066.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;