Id Trinity | TRINITY_DN49612_c0_g1_i4 |
---|---|
Name Transcript | Ll_transcript_415167 |
Sequence | CATTTATGTAACTGCTTTTGTTTCTATTACTCATGTTAATGGTGCTAATTATATGCCAGGAACTAATACCACTGTGCTGTGTTCTGCTCCTGATATAAAC CCTATGGCGCTTCGTTTTGAGGTTCTTGCCAGGTTCAACCGAGCTCGTGCAGCTCGATTGACACTCCCTCACTTTGTGTGTGAAACGCCTTTATTTATGC CAGTAGGCACACAAGGGACTATAAAAGGATTGACTAATAGCCAGCTTGAGGATATTGGCTGCCA BLAST |
Tissue | pods |
Gene name | LI_gene_170792; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_415167
Blastp | - |
---|---|
Blastx | Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 57.41% of identity |
Eggnog | Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, resulting in the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine) (By similarity)(COG0343) |
Kegg | Link to kegg annotations (393985) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416066.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |