Id Trinity | TRINITY_DN49694_c1_g1_i2 |
---|---|
Name Transcript | Ll_transcript_415401 |
Sequence | AGGTGAGTTAGTAGAAGATGGGGTTCCAGTTTGTGAAGGTGGCAGTGGAAGCAGTGAAGAATCTGATGTTGGAAGTGATCTTTATAAGAATGAGGATGAC AAACAAAGGCTTGCGAAAATGACTGAACTTGAAAGAGAAATGATTTTGTCTGATAGAGCAGCTAAGAAAGGTGAGTTAGTAGAAGATGGGGTTCCAGTTT GTGAAGGTGGCAGTGGAAGCAGTGAAGAATCTGATGTTGGAAGTGATCTTTATAAGAATGAGGATGACAAACAAAGGCTTGCGAAAATGACTGAACTTGA AAGAGAAATGATTTTGTCTGATAGAGCAGCTAAGAAAGGTGA BLAST |
Tissue | pods |
Gene name | LI_gene_171475; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_415401
Blastp | Protein RTF1 homolog from Arabidopsis with 52.33% of identity |
---|---|
Blastx | Protein RTF1 homolog from Arabidopsis with 75% of identity |
Eggnog | Rtf1, Paf1 RNA polymerase II complex component, homolog (S. cerevisiae)(COG5296) |
Kegg | Link to kegg annotations (AT1G61040) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_015968228.2) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |