Ll_transcript_455156

• Id Trinity: TRINITY_DN49725_c0_g1_i9
• Name Transcript: Ll_transcript_455156
• Sequence: GGAAGAATGGATTTACTTTGGAAGAGGATCCAAATGCACCGCCTGGATGCCGTTATAAGTTAACATCTGTCCCCTTCAGTAAAAACATAATGTTTGGAGT TGAAGATGTTAAGGAGCTGATCTCTACCCTGTCTGATGAGCATGGGGAATGTTCCATTATTGGTAGTTATAAATTGGATACCTCAGGCTCTATTTGCCCT TCGAGAGTTCGTGCAATGTTGGCTTCCCGTGCATGTCAATCATCAACTATGGTTGGTGATCCACTTGATAGAAATGAAATGCAGAAGGTGGTAAATTGTT ACTTTAAGCACCACTCTTTTTCTTTACATTAAATACACACACACATTGAAAAAAATGATGCAAAAGTGAACTGAG
• Tissue: pods
• Gene name: LI_gene_171738;
• Additional information: details;

Expression of Ll_transcript_455156

FPKM

• PAB: 0
• PNAB: 0.3
• PS1: 0
• PS2: 0
• PS3: 0
• PW1: 0
• PW2: 0
• PW3: 0.2

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_455156

• Blastp: DNA mismatch repair protein PMS1 from Arabidopsis with 68.04% of identity
• Blastx: DNA mismatch repair protein PMS1 from Arabidopsis with 68.04% of identity
• Eggnog: This protein is involved in the repair of mismatches in DNA. It is required for dam-dependent methyl-directed DNA mismatch repair. May act as a molecular matchmaker , a protein that promotes the formation of a stable complex between two or more DNA-binding proteins in an ATP-dependent manner without itself being part of a final effector complex (By similarity)(COG0323)
• Kegg: Link to kegg annotations (AT4G02460)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019441764.1)
• Pfam: MutL C terminal dimerisation domain (PF08676.10)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;