Id Trinity | TRINITY_DN49732_c0_g1_i6 |
---|---|
Name Transcript | Ll_transcript_454309 |
Sequence | GGAGGTGAAGAGGCTTTGCTTGGCATTTGAGCAACAGGTTCATATTTGACAGTTTTCAGCGCATTATTTATTTCTCATTCCAGTAAATAGTTAAAGAGTG AGAGTATATGTGATTGATTACCATGCTGCTCTGTTATGCAGTTCCATTACGCCGTATTCTTTGCATACATGAGGCTAAGGGAGCAGGAGATCAGGAACCT AATGTGGATTTC BLAST |
Tissue | pods |
Gene name | LI_gene_171776; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_454309
Blastp | - |
---|---|
Blastx | V-type proton ATPase subunit d1 from Arabidopsis with 100% of identity |
Eggnog | ATP synthase, subunit(COG1527) |
Kegg | Link to kegg annotations (AT3G28710) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003621126.2) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |