Id Trinity | TRINITY_DN49749_c1_g1_i15 |
---|---|
Name Transcript | Ll_transcript_455397 |
Sequence | GCCCTATTTCCGCAGAGACAGAAAAAAGGTTGAGTCGAAGAGAAGAAAATATGGATGAGGAAGAGCACGAGGTTTACGGAGGAGAGATCCCCGACGTCGA AGGAGATCACGACAATCCTGACATCGATATGTCCGCCGCCGATGATGACGCCGCCGTGAAGGAGCTCGACGAGATGAAGCGGCGCTTGAAGGAGATGGAA GAGGAAGCCGCCGCTCTCCGCGAGATGCAAGCTAAGGTTGAGAAAGAGATTGGCTCTGTTCAAGATCCTGCTGCTGCTGCTTCTCTGGCAAACAAGGAGG AGGCAGATACTCGATCTGTTTTTGTTGGCAATGTTGATTATGCATGTACACCAGAAGAAGTGCAGCAACACTT BLAST |
Tissue | pods |
Gene name | LI_gene_171890; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_455397
Blastp | Polyadenylate-binding protein 3 from Arabidopsis with 78.18% of identity |
---|---|
Blastx | Polyadenylate-binding protein 2 from Arabidopsis with 71.43% of identity |
Eggnog | Polyadenylate-binding protein(ENOG4111PFV) |
Kegg | Link to kegg annotations (AT5G10350) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019463812.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |