Id Trinity | TRINITY_DN49946_c3_g1_i27 |
---|---|
Name Transcript | Ll_transcript_458687 |
Sequence | CTCCGGTAGTCATGAGCCAAAAATGCCCTTTAGTTATGGGTCAAAAGTAACCCTTCGCTTGGTCCAGAAGGCTTCTATGGAGGGGGCGTGTTGGGAAGGG CATACACTATCTTCTGTAGATGAAGTTGCTGAGGTTAAAAGGCTGGTTGAAAATGAAAGTAAAAGGAGAAAGGCAGCTGAAGAAGAGGTAGAAAATCTAA AAAGTCAGCTGGGAAAATATACACAAGCAGAGGAAGGAGGGGATGAGGAGATTATAAAGTTTTGCAACATCTTGGAGGATGAGGCCAATCAGAAAAAGAA ACTTGAAGAAGAAATAATAATATTAAGAAGTCAGTTATTGCAACTGAACTTTGAAGCTGACCAG BLAST |
Tissue | pods |
Gene name | LI_gene_173459; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_458687
Blastp | Kinesin-like protein KIN-UB from Arabidopsis with 55.95% of identity |
---|---|
Blastx | Kinesin-like protein KIN-UB from Arabidopsis with 55.95% of identity |
Eggnog | Kinesin family member(COG5059) |
Kegg | Link to kegg annotations (AT1G01950) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003552346.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |