Id Trinity | TRINITY_DN49988_c0_g1_i10 |
---|---|
Name Transcript | Ll_transcript_456511 |
Sequence | CTTCGCTACAAGCTCCTCGGAGGTCTTGCTGTCAGAAGGGCCTGCTATGGTGTTTTGAGATTCGTTATGGAAAGTGGTGCTAAGGGATGCGAGGTCATTG TTAGTGGAAAGTTGAGGGCCCAGAGAGCCAAATCCATGAAGTTCAAGGACGGGTACATGATTTCTTCCGGGCAACCCGTTAAGGATTACATCGACTCTGC AGTGAGACACGTGCTCCTCAGACAGGTTTTTACTTCTGTTCTTCATATATACCTCATTGCTAATGAGTTCTTTTGTTATATTGCAGTGTGATTATGCTAA TCAAGATTTCCTTTGCTATTTTAGGGTGTTCTCGGTATTAAGGTT BLAST |
Tissue | pods |
Gene name | LI_gene_173788; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_456511
Blastp | - |
---|---|
Blastx | 40S ribosomal protein S3-2 from Arabidopsis with 94.67% of identity |
Eggnog | Binds the lower part of the 30S subunit head. Binds mRNA in the 70S ribosome, positioning it for translation (By similarity)(COG0092) |
Kegg | Link to kegg annotations (AT3G53870) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014502725.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |