Id Trinity | TRINITY_DN50014_c1_g1_i10 |
---|---|
Name Transcript | Ll_transcript_532939 |
Sequence | ATTTTCGGTTCTATTAATGAAGATTTATGTAGTGATTTTAGCAAAATGATGCAAGGAGAATTTGAAATGTCCATGATGGGAAAGTTGAACTACTTTCTTG GACTTCAAATAAAACAGCTTGATAATGGCATATTCGTGAGTCAATCGAAATACTACAAAGACTTGTTGAAAAGATTCGATATGGATGACTGCAAGCCTAT AGCTACTCCTATGGGATCAGGCACATACATCGATGCAGATGAACCCGGAAAATGTATTGATATATCCAAATATCGAGTGATTTGTGACCCGAATCTACAA CATTTCGGCGTGTCTACAAATGGTGAAACTAAAGTGCCTCTGAATCTTCGCGAAAGCAAGATTGATGTGGAAG BLAST |
Tissue | pods |
Gene name | LI_gene_173979; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_532939
Blastp | Uncharacterized mitochondrial protein AtMg00810 from Arabidopsis with 30.11% of identity |
---|---|
Blastx | Uncharacterized mitochondrial protein AtMg00810 from Arabidopsis with 30.11% of identity |
Eggnog | Retrotransposon protein(COG2801) |
Kegg | Link to kegg annotations (ArthMp070) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019434279.1) |
Pfam | Reverse transcriptase (RNA-dependent DNA polymerase) (PF07727.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |