Id Trinity | TRINITY_DN50016_c2_g1_i1 |
---|---|
Name Transcript | Ll_transcript_532527 |
Sequence | CAAAAATTGACAGCACAACAAACCACGCTCTTTGCATGTTTTCACTCTCAGTCTTACTTCTCAAAGAAGTTAGAAAGAAACCTCATTCAAACAGCGTTGA ACCATTTCCACACCACAATGCCCACCGCTAACGACGGCGGCGACAGGAGCAACTGCACCGTTTACTCCTCCGACGCCGGAAGCGTGGAGAGCTCTCTCTA CTTCCATTCTCGCCGGACGGTACTTGAGATGCTCCGAGACCGAGGCTACGACGTGCCCGACTCCGAGTTGACTCGGTCTCTTCCTGAGTTCCGTTCAATC TTCGGTGAAAAACCGAATCATGAAAGCCTCACTATCCGTGTTTCCCTTCTATCTGATCCCTCCAACAAGGTAAACATAACATTCATGTCCAAATAGGTAA CGTAACATAATGC BLAST |
Tissue | pods |
Gene name | LI_gene_173991; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_532527
Blastp | DNA-directed RNA polymerase V subunit 5C from Arabidopsis with 49.4% of identity |
---|---|
Blastx | DNA-directed RNA polymerase V subunit 5C from Arabidopsis with 49.4% of identity |
Eggnog | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates(COG2012) |
Kegg | Link to kegg annotations (AT3G54490) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427747.1) |
Pfam | RNA polymerase Rpb5, N-terminal domain (PF03871.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |