Id Trinity | TRINITY_DN50175_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_279549 |
Sequence | AGTTCCTTGAAGCTTCTTTCTCTATGGGCCCTGAATAATTGGATCCATCCTTCTTTCTACTTCCCAAACTGAAAAGCCCATACAACTTCCTGAACTCCCT CACTGTATGAACACTTTCTCTACAAATAACCGCAGCCGGTTCAGGCACATCGTAAGTGATCCGACCAGACCCGTTCCCATTCAACCTACCGTTAGATTGC GCTTGTAAAGCTGTGATAACGGTTTTCAAGGCCCGACTCGGTGAGTTCCGGTTGGATATCATAATCTCACCAACTTCAGCCGGGCTGAGCCGAGGCCCGG TCTGAGAAAAAACCTCTTCCACTTGTGGAAAAAGCTTATGTTCCTTCAACCCTAAGTAACTGTTCGCTAAAATCTTGAACGTTGAGAAATCACATAAGGG AAAGTGTATATGAACATC BLAST |
Tissue | pods |
Gene name | LI_gene_175203; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_279549
Blastp | AAA-ATPase At2g46620 from Arabidopsis with 54.01% of identity |
---|---|
Blastx | AAA-ATPase At2g46620 from Arabidopsis with 51.09% of identity |
Eggnog | Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465) |
Kegg | Link to kegg annotations (AT2G46620) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019414918.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |