Id Trinity | TRINITY_DN50205_c1_g1_i3 |
---|---|
Name Transcript | Ll_transcript_498217 |
Sequence | AAAGGATAAAGCTTGTTACAAAAAGTAGAGCATTTCCTAAGCTTGGTTATGGAGAAGCTGGTTCTACACTCTCCTTCTATTCCCACTCCCACACCACAAC AACAGTTCCTCTTTCATAACTCTCTCTTCCCATCTTTCAAATCTCGAACTCCATTCCACCAAACTTCTTCATATCTCTCTTGCATAACCACCACTAGAAG AAACCCTCACTTCCAAGCACTCGCCAATGGTGATGCTGAGATTGTCGATGATGAATTGTCCTTTTTGTCCCTCACTGGTAAGCCTGATAGAAACTTGGCC TTGCTCGATGATTATGAATCTGATGAGCTCGATTTTGATTCTGACCCCAATCACCGAAGCGGATATGTGGCTTTACTTGGCAAGCCAAATGTTGGGAAGA GCACATTAGCAAATCAAATGGTTGGCCAAAAGTTGTCGATAGTGACAGATAAACCTCAAACAACAAGGCATCGGATTCTTTGTATTTGTTCCAGCCCAGA TTATCAGTGATTTAATAAAGTGGGGTAATTCAAATTTACAAAAAGTTCCCTTAACAGTTAACACCCTACAAATTCATGGTACTTTATGACACACCTGG BLAST |
Tissue | pods |
Gene name | LI_gene_175424; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_498217
Blastp | GTPase ERA-like, chloroplastic from Arabidopsis with 67.65% of identity |
---|---|
Blastx | GTPase ERA-like, chloroplastic from Arabidopsis with 67.65% of identity |
Eggnog | An essential GTPase that binds both GDP and GTP, with rapid nucleotide exchange. Plays a role in 16S rRNA processing and 30S ribosomal subunit biogenesis and possibly also in cell cycle regulation and energy metabolism (By similarity)(COG1159) |
Kegg | Link to kegg annotations (AT5G66470) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019432261.1) |
Pfam | 50S ribosome-binding GTPase (PF01926.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |