Ll_transcript_498234

• Id Trinity: TRINITY_DN50205_c1_g8_i1
• Name Transcript: Ll_transcript_498234
• Sequence: GGTGCACTCATGCTCTGTGACATGGCTCACATTAGTGGCCTTGTTGCTGCTCAGGAAGCTAATAACCCATTTGAGTACTGTGACATTGTCACAACAACAA CCCACAAGAGCTTGAGGGGTCCTAGGGCCGGTATGATCTTCTACCGGAAGGGACCTAAACCACCGAAGAAGGGACAGCCTGAGAATGCAGTTTATGATTT TGAAGACAAAATCAACTTTGCTGTCTTCCCTTCCCTTCAGGGTGGTCCTCACAATCACCAGATTGGTGCTCTTGCTGTTGCTTTGAAACAGGCC
• Tissue: pods
• Gene name: LI_gene_175431;
• Additional information: -

Expression of Ll_transcript_498234

FPKM

• PAB: 54.3
• PNAB: 153.9
• PS1: 45.2
• PS2: 25.7
• PS3: 32.4
• PW1: 226.5
• PW2: 133.2
• PW3: 111

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_498234

• Blastp: -
• Blastx: Serine hydroxymethyltransferase 4 from Arabidopsis with 94.9% of identity
• Eggnog: Catalyzes the reversible interconversion of serine and glycine with tetrahydrofolate (THF) serving as the one-carbon carrier. This reaction serves as the major source of one-carbon groups required for the biosynthesis of purines, thymidylate, methionine, and other important biomolecules. Also exhibits THF- independent aldolase activity toward beta-hydroxyamino acids, producing glycine and aldehydes, via a retro-aldol mechanism (By similarity)(COG0112)
• Kegg: Link to kegg annotations (AT4G13930)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019416596.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;