| Id Trinity | TRINITY_DN50227_c1_g1_i7 |
|---|---|
| Name Transcript | Ll_transcript_498040 |
| Sequence | GCCAAGTTGCACCATGGCCATCTAGCAAATGCAGATGGGAACGGAGATTGGGTTTTAACAATATTTACAGCTCTATCACTTCATAGCTTGGATGTAATAG TCATTAGTACACAAGGAGATCTTCCATTTTGCTTGATGTGTTACTTTTATCTTTTACACATTCTTGGTTCTCTTTCATCCAGATAATTGATGTTCTGGAA CTTATCCCTTCCCATGTGGTGGTGGTGTTTGACCATGATGGAGTTCCTTTTGGTCCTACTTATAATTCATCAAAAGGAAGTTTTACTGCAAAAGGCCAAA ATTTTCGCCACAATCTATACCCCTCATACAAGAGCAATCGTCCTCCAACTCCTGATACTATTGTTCAGGGGCTTCAATATCTCAAAGCATCCATCAAGGC TATGTCCATAAAAGTCATTGAGGCAAGGATAAGTTGCAGATTTATATTGCTTATTGATTTTAAGGGTGTACTGCAATTCATATAAATCCATTCAAAGACA GGTTCCAGGTGTAGAAGCAGATGATGTGATTGGAACATTAGCCATAAGGAGTGTTGATGCTGGGTACAAGGTCCGAGTTGTCTCCCCAGAC BLAST |
| Tissue | pods |
| Gene name | LI_gene_175620; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_498040
| Blastp | - |
|---|---|
| Blastx | DNA polymerase I from Haemophilus with 33.8% of identity |
| Eggnog | Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA (By similarity)(COG0258) |
| Kegg | Link to kegg annotations (HI0856) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019424416.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |