Id Trinity | TRINITY_DN50240_c2_g2_i9 |
---|---|
Name Transcript | Ll_transcript_496721 |
Sequence | TTCACTTTCTCTTCTCCCGATTTCCGAATTTTTGATTCAATTTTGGGTTCCAAAATACATAATCATCTTCTACTTTCATTATTCATCACTCACTCTCTTT CTCTGTTTTTAACAGGAAACGCAGCGTTTGCTCAGTGAACCTGCTCCTGGAATTAGCGCTTCGCCTTCAGAAGAAAATATGCGATATTTCAATGTGATGA TCCTTGGCCCATCTCAGTCACCTTATGAAGGGGGGGTTTTCAAGTTAGAAC BLAST |
Tissue | pods |
Gene name | LI_gene_175710; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_496721
Blastp | - |
---|---|
Blastx | Ubiquitin-conjugating enzyme E2 36 from Arabidopsis with 95.65% of identity |
Eggnog | ubiquitin-conjugating enzyme(COG5078) |
Kegg | Link to kegg annotations (AT1G16890) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019425255.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |