Ll_transcript_403662

• Id Trinity: TRINITY_DN50554_c0_g1_i8
• Name Transcript: Ll_transcript_403662
• Sequence: ATAAGATTGGTGTTTTTTATGGAAATCCAGAAGTGACAAGTGGTGGAATTGCATTGAAGTTTTTCGCGTCACTTCGACTAGAAGTTCGTTCTATAGGGAA GATAAAGTCTGCTAAAGGAGATGAAGAAATTGGCCTTAAAGTTCGTGTAAGAGTGCAAAAGAGCAAGGTATCAAGGCCATACAAAATAGCTGAATTCGAG ATTATATTTGGGGAGGGCGTCAGTAAACTGGGTTGCATTTTAGATTGTGCAGAAATGATGGATGTTGTCTTAAAGAA
• Tissue: pods
• Gene name: LI_gene_178080;
• Additional information: -

Expression of Ll_transcript_403662

FPKM

• PAB: 5.3
• PNAB: 16.9
• PS1: 15.7
• PS2: 9.7
• PS3: 16.2
• PW1: 14.9
• PW2: 9.9
• PW3: 11.2

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_403662

• Blastp: -
• Blastx: DNA repair protein recA homolog 1, chloroplastic from Arabidopsis with 84.62% of identity
• Eggnog: Can catalyze the hydrolysis of ATP in the presence of single-stranded DNA, the ATP-dependent uptake of single-stranded DNA by duplex DNA, and the ATP-dependent hybridization of homologous single-stranded DNAs. It interacts with LexA causing its activation and leading to its autocatalytic cleavage (By similarity)(COG0468)
• Kegg: Link to kegg annotations (AT1G79050)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019446739.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;