Id Trinity | TRINITY_DN50560_c1_g1_i12 |
---|---|
Name Transcript | Ll_transcript_403324 |
Sequence | AGGTTAACAACACAGATGCTGAGGGTAGGCTCACACTTGCAGATGCTCTGGTATATGCTTGTAACCAAGGTGTCGAAAAGATAATTGACTTGGCAACGTT AACTGGGGCCTGTATAGTTGCTCTTGGACCTTCAGTTGCAGGTGTGTTTACCCCCAATGATGACCTGGCAAAAGAAATTTTTGATGCTTCTGAAGCAAGT GGAGAGAAATTATGGAGGTTGCCGTTAGAAGATAGTTACTGGGAGTCCATGAAATCTGGAGTAGCTGATATGGTGAACACTGGTGGTCGACAAGGTGGTG CTATTACTGCTGCTCTTTTCTTGAAGCAGTTTGTTGATGAAAAGGTTAAATGGGGGCATATTGACTTGGCTGGTCCAGTGTGGAATGACAAGAAACGTTC TGCGACAGGATTTGGTGTTGCAACTTTAGTTGAAT BLAST |
Tissue | pods |
Gene name | LI_gene_178132; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_403324
Blastp | Leucine aminopeptidase 2, chloroplastic from Oryza sativa with 86.81% of identity |
---|---|
Blastx | Leucine aminopeptidase 2, chloroplastic from Oryza sativa with 86.81% of identity |
Eggnog | Presumably involved in the processing and regular turnover of intracellular proteins. Catalyzes the removal of unsubstituted N-terminal amino acids from various peptides (By similarity)(COG0260) |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019415349.1) |
Pfam | Cytosol aminopeptidase family, catalytic domain (PF00883.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |