Id Trinity | TRINITY_DN50680_c0_g1_i4 |
---|---|
Name Transcript | Ll_transcript_451467 |
Sequence | CATGAATTGAAAGCTATATACAAGTATGACCACTATTATTTTTAACTCCAAACTTGGATTTAATACATTTAAACTAACGTAGTTTTAAATGATTAGAACT GTTTGGGAGATCAAACAAAAAACATTGGTTGATATGGCTGTTGATCGAGGATGCTACATAGATCAGAGTCAAAGCTTAAATATTCACATTGAGCAGCCCA ACTTTGGAAA BLAST |
Tissue | pods |
Gene name | LI_gene_179081; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_451467
Blastp | - |
---|---|
Blastx | Ribonucleoside-diphosphate reductase large subunit from Arabidopsis with 81.58% of identity |
Eggnog | Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides (By similarity)(COG0209) |
Kegg | Link to kegg annotations (AT2G21790) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019462638.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |