Id Trinity | TRINITY_DN50758_c2_g1_i7 |
---|---|
Name Transcript | Ll_transcript_377977 |
Sequence | TAACAATTGCTGAGGTCATCGAGAATGAGTGGTTCAAGAAGGGATATAAGCCTCCTAGGTTTGAGCAGGCTAATGTTAGTCTCGATGATATAAATTCTAT TTTCAGTGAATCTATGGATTCACAAAATCTTGTTGTCGAGAGGCGCACAGAGGGGCCTGTGGCACCCGTGACCATGAATGCATTTGAGCTTATCTCTACA TCTCAGGGCCTCAACCTAAGTAGTCTTTTCGAGAAGCAAATGGGACTTGTTAAACGGGAAACGAGATTTACATCCAAATGTTCAGCAAATGAGATAATCT CAAAAATTGAGCAAGCAGCAGGGCC BLAST |
Tissue | pods |
Gene name | LI_gene_179665; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_377977
Blastp | CBL-interacting serine/threonine-protein kinase 23 from Arabidopsis with 78.3% of identity |
---|---|
Blastx | CBL-interacting serine/threonine-protein kinase 23 from Arabidopsis with 78.3% of identity |
Eggnog | Serine Threonine protein kinase(COG0515) |
Kegg | Link to kegg annotations (AT1G30270) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019417188.1) |
Pfam | NAF domain (PF03822.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |