Id Trinity | TRINITY_DN50835_c0_g1_i6 |
---|---|
Name Transcript | Ll_transcript_516682 |
Sequence | GTGAGAGCCAGCTACGGGACCTACTGTGTGGTTCAGAATATGTGGTCACATATGAAGATAAAGATGGAGATTGGATGCTTGTAGGGGATGTACCATGGGA GATGTTCACTGACACTTGCAGAAGGCTGAAAATCATGAAGGGTTCTGATGCCATTGGCTTAGCTCCCAGGGCCATGGAGAAGTCCAAAAGCAGGAGTTAG ATGTTGTCCGGGGACTGATATGAAGTTGTACCTGGTTTTGGTGGTTAAATACAGTTCTGATGTTATCTATGTTTTTAAGTCCCCGATGAGTTTGTCTTGA TCTGTTTACATTTGTTATTATTACTATAATATTTT BLAST |
Tissue | pods |
Gene name | LI_gene_180350; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_516682
Blastp | - |
---|---|
Blastx | Auxin-responsive protein IAA30 from Oryza sativa with 80% of identity |
Eggnog | Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations. Repression is thought to result from the interaction with auxin response factors (ARFs), proteins that bind to the auxin-responsive promoter element (AuxRE). Formation of heterodimers with ARF proteins may alter their ability to modulate early auxin response genes expression(ENOG410YEC3) |
Kegg | Link to kegg annotations (4352721) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019423994.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |