Id Trinity | TRINITY_DN50854_c0_g3_i12 |
---|---|
Name Transcript | Ll_transcript_514014 |
Sequence | GAAATAAGTTATCTCCTGGTATGAAGAGATACTTTATTCTCAAAATATAAACTTAGAATGTTCATATTTTATATACAATCGTCAGTCATCTAAAAACTCT TTATGAAGAATCCTTCAAAATATTGGACCAGATACCACATAGAGCAACTCGGGAATAGTTCTATAACTAAATCAAAGTTTTGTGTTGGGTTGTAGATAAA GTGAGAGAGGTGCTGAAGCTGGACCAGGAGATGAAGGATCTAGCACAGCTATTAATTGCTGAGCAGTCTCTTCTTGTCTTTGGGAGATCATACAACTATG CAACTGCTCTAGAGGGAGCTTTGAAAGTGAAGGAAGTGGCACTGATGCATAG BLAST |
Tissue | pods |
Gene name | LI_gene_180486; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_514014
Blastp | - |
---|---|
Blastx | Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2 from Mus with 60% of identity |
Eggnog | Catalyzes the first step in hexosamine metabolism, converting fructose-6P into glucosamine-6P using glutamine as a nitrogen source (By similarity)(COG0449) |
Kegg | Link to kegg annotations (14584) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019431214.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |