Id Trinity | TRINITY_DN50887_c0_g3_i1 |
---|---|
Name Transcript | Ll_transcript_516790 |
Sequence | TACCAAGGAAGAGTTTGTGCATGTTCTTCGCCGGCAAAGTACTGGATTTCCGAGAGGAAGCTCGAAATATAGAGGTGTAACTTTGCACAAATGTGGAAGA TGGGAATCTAGAATGGGTCAATTTTTAGGGAAAAAGTATGTTTATCTGGGTTTGTTTGACACTGAGGTTGAAGCAGCAAGGGCCTATGATAAAGCAGCAA TAAAATGCAATGGCAAAGAGGCTGTCACCAATTTTGATCCAAGCATCTATGACAATGAACTTAACTCTGAATCCACAGGTACTACTATCAATGCTGATCA CAATCTAGACâBLAST |
Tissue | pods |
Gene name | LI_gene_180766; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_516790
Blastp | Floral homeotic protein APETALA 2 from Arabidopsis with 90.38% of identity |
---|---|
Blastx | Floral homeotic protein APETALA 2 from Arabidopsis with 90.38% of identity |
Eggnog | floral homeotic protein APETALA(ENOG410YBZ8) |
Kegg | Link to kegg annotations (AT4G36920) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019434829.1) |
Pfam | AP2 domain (PF00847.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |