Id Trinity | TRINITY_DN50921_c4_g2_i1 |
---|---|
Name Transcript | Ll_transcript_388872 |
Sequence | GAAAGATTGCAATTAGAAGGATAGATAACACAACAAGCCGTCAAGTAACTTTCTCAAAGAGAAGAAATGGATTGCTTAAGAAAGCTAAAGAATTGTCCAT TTTATGTGATGCTGAAGTTGGATTGATTGTGTTTTCCAGCACTGGAAAGCTTTATGATTATGCTAGCACCAGCATGAAATCTGTGCTTGAGCGTTACAAG AGGCTAAAAGAGGAGAGTCATCAGCTAATGAATCCTGCTTTAGAAATCAAGTTTTGGCAGAGAGAAGCAGCAAGCTTGAGGCAGCAACTGCA BLAST |
Tissue | pods |
Gene name | LI_gene_181012; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_388872
Blastp | - |
---|---|
Blastx | MADS-box transcription factor ANR1 from Arabidopsis with 81.52% of identity |
Eggnog | Transcription factor(COG5068) |
Kegg | Link to kegg annotations (AT2G14210) |
CantataDB | Link to cantataDB annotations (CNT0001490) |
Mirbase | osa-MIR444d (MI0006976) |
Ncbi protein | Link to NCBI protein (XP_019425955.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |