Id Trinity | TRINITY_DN50926_c0_g1_i3 |
---|---|
Name Transcript | Ll_transcript_388191 |
Sequence | TCAGGATGTTACTATGAAGATTATGTCCTTTTCTCAACAAGGATCACATGCTATATGCATTCTCTCTGCAAATGGCATGATTTCAAATGTTACACTTCGT CAACCGACTTCTTCAGGGGGTACTCTAACATATGAGGGACGGTTTGAGATTCTGTCCTTATCTGGTTCCTTCATGCCAACTGAAAATGGAATTGCGAGAA GCAGATCTGGTGGGATGAGTGTCTCTTTGGCAGGTCCAGATGGCCGAGTGATGGGGGGTGGACTAGCTGGTTTGCTGATAGCTGCAGGTCCTGTGCAGGT TGTTGTGGGTAGTTTTCTTC BLAST |
Tissue | pods |
Gene name | LI_gene_181054; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_388191
Blastp | AT-hook motif nuclear-localized protein 1 from Arabidopsis with 82.08% of identity |
---|---|
Blastx | AT-hook motif nuclear-localized protein 1 from Arabidopsis with 82.08% of identity |
Eggnog | AT hook motif domain containing protein, expressed(ENOG410YFD3) |
Kegg | Link to kegg annotations (AT4G12080) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427844.1) |
Pfam | Domain of unknown function (DUF296) (PF03479.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |