Ll_transcript_388452

• Id Trinity: TRINITY_DN50983_c3_g1_i7
• Name Transcript: Ll_transcript_388452
• Sequence: GGGCTGGTATGTTTGTTCGAGATGCCAAGGCACTTTGTCCCCACCTTGTTATCTTTCCTTACAACTTTGAAGCTTATGAGGAAGTAAGAAGCAATAGGGT GTTCATAGTTGAATAATTTACAAAGAAGAATATTTTATTTCTCAACATATATTTTTGAGTAGCTGATCAATTTTATAGTATACTACATCGACATTGCAGC AAAGTGCAGG
• Tissue: pods
• Gene name: LI_gene_181475;
• Additional information: -

Expression of Ll_transcript_388452

FPKM

• PAB: 0
• PNAB: 0
• PS1: 0
• PS2: 0
• PS3: 0
• PW1: 0.8
• PW2: 0.7
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_388452

• Blastp: -
• Blastx: DNA repair protein REV1 from Arabidopsis with 55.07% of identity
• Eggnog: Poorly processive error-prone DNA polymerase involved in untargeted mutagenesis. Copies undamaged DNA at stalled replication forks which arise in vivo from mismatched or misaligned primer ends. These misaligned primers can be extended by polIV. Exhibits no 3-5 exonuclease (proofreading) activity. May be involved in translesional synthesis in conjunction with the beta clamp from polIII (By similarity)(COG0389)
• Kegg: Link to kegg annotations (AT5G44750)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019421545.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;