| Id Trinity | TRINITY_DN51156_c0_g1_i38 |
|---|---|
| Name Transcript | Ll_transcript_460181 |
| Sequence | ATTAATTCTATTGTTGCTGCAAGGTAATGCAATTTCTTTTCTCTTCTTTAGCTATTGATCATTGTATCTTTCTTTTATGTGGAGCTATTTTGATTATCAG TCACTATCCTCTCTCAATTATTTTGGTTGGGGTTGGAGATGGACCATGGGATGAAATGCAGCATTTTGATGATAGCATCACTCAGCGCTTATTTGACAAC TTTCAGâBLAST |
| Tissue | pods |
| Gene name | LI_gene_182810; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_460181
| Blastp | - |
|---|---|
| Blastx | E3 ubiquitin-protein ligase RGLG3 from Arabidopsis with 70.73% of identity |
| Eggnog | copine family(ENOG410XPC8) |
| Kegg | Link to kegg annotations (AT5G63970) |
| CantataDB | Link to cantataDB annotations (CNT0001273) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003525130.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |