Id Trinity | TRINITY_DN51175_c4_g1_i1 |
---|---|
Name Transcript | Ll_transcript_461749 |
Sequence | CTGTGAATGGGCATGTTAGATGCCTTAGACTAGTTGTCGCCGACTTTGTTCCAAGTGCTCCTTATGAAGCTTTATATGCTCGCTCAGATGCTGACACGAC TGATGGATCAGATGTGAAAAGCAAAGGTGAACAAAGTGAATTGTCTAAGTTTGTAAACAAGGTAGCTGAGGGTGGTATTACTGCCCTTCATATGGCTGCA TTAAATGGGCATTTTGATTGTGTACAACTGCTACTTGATCTTAATGCAAATGTGTCAACTACAACAATTCATCATGGAACATCGATTGATATAATAGGTA CATCTTTCATTTAACTAAACTAAATATGTTTGTTTGTTTCCCTCATCAAAATTACCAATGTGCTTTGATATAGGCCCCGGGAGCACTCCGTT BLAST |
Tissue | pods |
Gene name | LI_gene_182957; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_461749
Blastp | E3 ubiquitin-protein ligase XBAT33 from Arabidopsis with 64.65% of identity |
---|---|
Blastx | E3 ubiquitin-protein ligase XBAT33 from Arabidopsis with 64.65% of identity |
Eggnog | Ankyrin Repeat(COG0666) |
Kegg | Link to kegg annotations (AT5G07270) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019464952.1) |
Pfam | Ankyrin repeats (many copies) (PF13637.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |