Id Trinity | TRINITY_DN51183_c1_g6_i1 |
---|---|
Name Transcript | Ll_transcript_460080 |
Sequence | AAGAAGGCTTTCACCAAGTCTTCCAAGAAGTGGCAGGATGACCTTGGACGCAAGTCAATTGAAAGGAATTTCAAGAAAATGATCCGCTACTGCACAGTGA TCAGAGTTATCTGCCACACTCAGATGAAGCTGTTGAGGCATCGCCAGAAGAAGGCACACATTATGGAGATCCAGTTGAATGGAGGATCTGTAGAAGACAA GGTTAAGTGGGCACGTGAGCATTTGGAGAAGCCAGTACCTGTAGCC BLAST |
Tissue | pods |
Gene name | LI_gene_183017; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_460080
Blastp | - |
---|---|
Blastx | 60S ribosomal protein L3 from Sophophora with 75.61% of identity |
Eggnog | One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit (By similarity)(COG0087) |
Kegg | Link to kegg annotations (Dmel_CG4863) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020232633.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |