Ll_transcript_519476

• Id Trinity: TRINITY_DN51215_c0_g1_i1
• Name Transcript: Ll_transcript_519476
• Sequence: ATTCCATCAAACACAGATCTCACTCTGAAACTTGTTCTTCTCTCATAATCGGTCTGCAATCATGAAGCTTGATACCAGTGGTCTTGAATCATTCTCTACA CAAATCGGATTTCAAAGCGACGTCGTTGGAGATATTTCAGCTGCCCCATCATTCGATCTTCCCAATTCAAGCGACGTGAGTAATATTTTGCAAATTGCGG TTAATAGGGTTTAAGATGAATTACTAATTGGTTGTTAGGGTTGAAATGCAATGATTCTTATGCAAAAG
• Tissue: pods
• Gene name: LI_gene_183242;
• Additional information: -

Expression of Ll_transcript_519476

FPKM

• PAB: 1.1
• PNAB: 0.3
• PS1: 0
• PS2: 2.8
• PS3: 3.5
• PW1: 2.3
• PW2: 1.6
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_519476

• Blastp: -
• Blastx: Proteasome subunit beta type-5-B from Arabidopsis with 48.08% of identity
• Eggnog: The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity (By similarity)(ENOG410XQRP)
• Kegg: Link to kegg annotations (AT3G26340)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019463074.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;