Id Trinity | TRINITY_DN51227_c2_g1_i21 |
---|---|
Name Transcript | Ll_transcript_519139 |
Sequence | ACAATGGATGTAGCTTCAGCTTCCCCTCGACGGTATTTCTTTGAGTTGCCTTCGTTCCATAGCTGAGTGCTTGGGGCAAGGTCATGAGCTTTTTTGCGAC AGCTGAACATGAGAGGGAAAGACTCAAGTATTTTGCTTCGCCTGAAGGAAGAGATGACCTGTACCAATACAATCAGAAGGAAAGGAGAACTGTTCTTGAG GT BLAST |
Tissue | pods |
Gene name | LI_gene_183332; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_519139
Blastp | - |
---|---|
Blastx | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 82.5% of identity |
Eggnog | Component of the sulfite reductase complex that catalyzes the 6-electron reduction of sulfite to sulfide. This is one of several activities required for the biosynthesis of L- cysteine from sulfate. The flavoprotein component catalyzes the electron flow from NADPH - FAD - FMN to the hemoprotein component (By similarity)(COG0369) |
Kegg | Link to kegg annotations (AT3G02280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_017409072.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |