| Id Trinity | TRINITY_DN51227_c2_g1_i21 |
|---|---|
| Name Transcript | Ll_transcript_519139 |
| Sequence | ACAATGGATGTAGCTTCAGCTTCCCCTCGACGGTATTTCTTTGAGTTGCCTTCGTTCCATAGCTGAGTGCTTGGGGCAAGGTCATGAGCTTTTTTGCGAC AGCTGAACATGAGAGGGAAAGACTCAAGTATTTTGCTTCGCCTGAAGGAAGAGATGACCTGTACCAATACAATCAGAAGGAAAGGAGAACTGTTCTTGAG GT BLAST |
| Tissue | pods |
| Gene name | LI_gene_183332; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_519139
| Blastp | - |
|---|---|
| Blastx | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 82.5% of identity |
| Eggnog | Component of the sulfite reductase complex that catalyzes the 6-electron reduction of sulfite to sulfide. This is one of several activities required for the biosynthesis of L- cysteine from sulfate. The flavoprotein component catalyzes the electron flow from NADPH - FAD - FMN to the hemoprotein component (By similarity)(COG0369) |
| Kegg | Link to kegg annotations (AT3G02280) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_017409072.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |