Id Trinity | TRINITY_DN51312_c1_g3_i1 |
---|---|
Name Transcript | Ll_transcript_289999 |
Sequence | TCCCAGTCACTTCATCAGTGGGGTGGCAGCAGGAGGCAGAGGATTAAATGACTTTCAGGAGTCTGTAAGATCACCCAAGGTCTTGCAAGGTCAAGAAAAT TCAGGTTTTGTGTCACACTATTATGGACGTGACACAGTAACCAACCGGTCAGATTTTGAGATGAACTCTCCAAGTCATCCAAATCTAGCATCAACTGGAG GAAGAAAGGGCATCTCTGCCGAGCTTATGAGTGTTCACCCTTTAAGTTATGCAGCCTTTGTGGAAACTAATAGGTTTCCAAGGGTCTTGCAAGGTCAAGA AATATGTCCACTGAATTCCCTCACGGGAAAGATTG BLAST |
Tissue | pods |
Gene name | LI_gene_183971; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_289999
Blastp | Auxin response factor 4 from Arabidopsis with 46.39% of identity |
---|---|
Blastx | Auxin response factor 4 from Arabidopsis with 46.39% of identity |
Eggnog | auxin response factor(ENOG4111D9H) |
Kegg | Link to kegg annotations (AT5G60450) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019448713.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |