Id Trinity | TRINITY_DN51322_c0_g1_i25 |
---|---|
Name Transcript | Ll_transcript_288490 |
Sequence | CAGTCTGACATTTATTTCTGTTTGGCTACAGATTCAGTACTGCCCAGAAATTAGATAAACTCGGGATGCGAGGAAGTGATACGTATGTATGCATGTCTAA TAAGAAGTTTTATATATTTAACCCATAATACCATATCCAACAAACTTCCCTTACTAATAATATGGGATTGTGTTCTTTGGCAGATGTGAGCTTGTCTTTG AAAATTGCTTTGTTCCAGAAGAAAATGTTCTTGGGAAAGAAGGGAAAG BLAST |
Tissue | pods |
Gene name | LI_gene_184058; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_288490
Blastp | - |
---|---|
Blastx | 2-methylacyl-CoA dehydrogenase, mitochondrial from Solanum with 90.48% of identity |
Eggnog | Dehydrogenase(ENOG410XNMY) |
Kegg | Link to kegg annotations (102589539) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019413615.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |