Id Trinity | TRINITY_DN51359_c2_g1_i2 |
---|---|
Name Transcript | Ll_transcript_288430 |
Sequence | CTTAAAGAAAAATGAAGATGGCATATCAATTCTGTTCTACCTTCAGAAGATATATCCAGATGAGTGGAAAAACTTTCTTGCCAGAATCGGCCGTGATGAA AATGCACTTGACACAGATCTTTATGATAGTAGTGATATCCTTGAACTGCGTTTTTGGGCTTCTTATCGGGGACAAACACTTGCTAGAACAGTTCGTGGAA TGATGTATTATAGGAAAGCTCTTATGCTTCAAACCTATCTGGAGAGGACAACAGCTGGAGATTTGGAGGCTGCAATTGGTTGTGATGAAGTAACTGATAC ACATGGCTTTGATT BLAST |
Tissue | pods |
Gene name | LI_gene_184334; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_288430
Blastp | Callose synthase 9 from Arabidopsis with 75.73% of identity |
---|---|
Blastx | Callose synthase 9 from Arabidopsis with 75.73% of identity |
Eggnog | synthase(ENOG410XQ8V) |
Kegg | Link to kegg annotations (AT3G07160) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019428289.1) |
Pfam | 1,3-beta-glucan synthase component (PF02364.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |